Vet Pathol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kiupel, M.
Right arrow Articles by Mittal, S. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kiupel, M.
Right arrow Articles by Mittal, S. K.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Vet Pathol 38:74-82 (2001)
© 2001 American College of Veterinary Pathologists

Viral Replication and Lesions in BALB/c Mice Experimentally Inoculated with Porcine Circovirus Isolated from a Pig with Postweaning Multisystemic Wasting Disease

M. Kiupel, G. W. Stevenson, J. Choi, K. S. Latimer, C. L. Kanitz and S. K. Mittal

Animal Disease Diagnostic Laboratory (MK, GWS, CLK) and Department of Veterinary Pathobiology (MK, GWS, JC, CLK, SKM), Purdue University, West Lafayette, IN; and College of Veterinary Medicine, Department of Veterinary Pathology, University of Georgia, Athens, GA (KSL)


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Eight-week-old BALB/c mice were either sham inoculated (control mice) or were inoculated intraperitoneally (IP) and intranasally (IN) with a single (sPCV mice) or multiple (mPCV mice) doses of porcine circovirus 2 (PCV2). Four control mice and 4 sPCV mice were sacrificed 7, 14, 28, and 42 days postinoculation (PI). All 4 mPCV mice were sacrificed 42 days PI. In addition, 7-day and 14-day pregnant BALB/c mice were either sham inoculated (control mice) or were inoculated IP and IN with a single dose of PCV2. Newborn mice were euthanatized 1, 8, and 15 days after birth. Necropsies were performed on all euthanatized mice and tissues were collected for histopathology, electron microscopy, in situ hybridization, and polymerase chain reaction (PCR). PCV2 replicated in 8-week-old BALB/c mice that were inoculated with PCV2 and caused fetal infection when inoculated into pregnant BALB/c mice at 7 days and 14 days of gestation. PCV was detected by in situ hybridization and PCR in sPCV mice on days 7, 14, 28, and 42 PI; in mPCV mice on day 42 PI; and in newborn mice from mothers inoculated with PCV at 7 days and 14 days of gestation at 1, 8, and 15 days after birth, but not in control mice. No clinical signs or gross lesions were found in sPCV or mPCV mice during the study. Microscopic lesions in sPCV mice and mPCV mice were characterized by expansion of germinal centers in lymphoid organs with large numbers of histiocytic cells and lymphoblasts, apoptosis of histiocytic cells in germinal centers, and mild lymphoid depletion of the paracortex. PCV nucleic acid was detected in the nuclei and cytoplasm of histiocytes and apoptotic cells in germinal centers in lymphoid tissues as well as in the nuclei of hepatocytes in the liver, in the nuclei of renal tubular epithelial cells, and in the cytoplasm of single lymphocytes in the thymus. Congenitally infected mice only had PCV nucleic acid detected in putative Kupffer cells in livers.


Key words: BALB/c mice; circovirus; mice; pigs; postweaning multisystemic wasting syndrome.

Porcine circovirus (PCV) was first isolated as a noncytopathic contaminant of a porcine kidney cell line (PK-15)31 and has been characterized as a small icosahedral DNA virus.29 The viral genome has been sequenced18 and the virion has been characterized ultrastructurally.27 Inoculation studies in pigs using PK-15–derived PCV did not result in clinical disease.2,30 Field isolates of PCV have been associated with congenital tremors (CT) type A28,11,12 and a recently described postweaning multisystemic wasting syndrome (PMWS) in pigs.1,3–6

CT type A2, the most common form of CT in North America, are associated with myelin deficiency and affected newborn pigs exhibit clonic contractions of skeletal muscles of varying severity that usually diminish and resolve by 4 weeks of age but that may continue until slaughter age.

MWS has been diagnosed with increasing frequency in the USA, Canada, and Europe.3,6,10,15,16,21,25 The syndrome is characterized by progressive weight loss, dyspnea, tachypnea, and icterus in postweaned pigs of approximately 8–12 weeks of age.4 Gross lesions in pigs with PMWS consist of generalized lymphadenopathy in combination with interstitial pneumonia, hepatitis, renomegaly, splenomegaly, gastric ulcers, and intestinal wall edema.4,10 The most distinct microscopic lesions in affected pigs are lymphoid cell depletion and granulomatous inflammation in lymphoid organs with inconsistently occurring clusters of intensely basophilic intracytoplasmic inclusion bodies in macrophages.4,6,10,15 PCV nucleic acid and circoviral antigen have been demonstrated within lesions in multiple organs of naturally diseased pigs with PMWS, and the characteristic intracytoplasmic inclusions in macrophages of pigs with PMWS consist of circoviral particles.3,6,14,20,23 Recently clinical disease and severe lesions compatible with those of PMWS have been reproduced in gnotobiotic pigs experimentally inoculated with PCV isolated from a pig with naturally occurring PMWS.13 Wasting disease has been reproduced in caesarian-derived and colostrum-deprived pigs infected dually with PCV and porcine parvovirus (PPV),1 and in gnotobiotic pigs inoculated with a cell-free filtered tissue homogenate containing only PCV and porcine reproductive and respiratory syndrome virus (PRRSV).13

Isolates of PMWS–associated PCV are genetically and antigenically different from the PK-15 cell PCV.3,9,18,21 Isolates of PCV that are genetically like PK-15 cell PCV are referred to as PK-15 PCV9 or PCV118 and those like the first-characterized PMWS isolates are referred to as PMWS PCV9 or PCV2.18 Although PMWS has been associated with infection by PCV2, but not PCV1, whether CT type A2 is caused by PCV2 or PCV1 or both is uncertain.

Inoculation of pregnant sows in the last third of gestation with a purified virus morphologically identical to PCV reproduced CT.8,11 The virus was confirmed as PCV by indirect immunologic methods; however, the genetic type of this virus is not known. Recently, PCV2 has been detected in large numbers of neurons in the brain and spinal cord of pigs with CT.26 Whether these neuron-associated isolates of PCV2 can cause CT when inoculated into susceptible pregnant swine is uncertain.

Antibodies that react with PCV1 were found in sera of febrile human patients and mice in Germany by means of indirect immunofluorescence assay and an enzyme-linked immunosorbent assay (ELISA).28 Double-staining indirect immunofluorescence assays, immunoelectronmicroscopy, and immunoblotting demonstrated that nonporcine antibodies reacted with PCV1 structural antigen in that study.28 Because of lower maximal optical densities (ODs) obtained at equal titers in ELISA with nonporcine than with porcine sera, antibodies in human patients and mice were suggested possibly to be caused by different species-specific viruses that share antigenic epitopes with PCV1.28 To date, circoviruses identical or similar to PCV have not been detected in humans or mice. Whether PCV can infect humans, mice, or other mammalian species is not known.

The aim of this study was to develop a BALB/c mouse model for PMWS to evaluate for viral replication and associated lesions. The following hypotheses were investigated: that PCV2 replicates in mice, that PCV2 causes lesions in mice that are similar to lesions of PMWS in pigs, that PCV2 crosses the placenta in mice and causes fetal infection, and that PCV2 causes CT in newborn mice after intrauterine infection.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Source of PCV isolate

The PCV inoculum was prepared from an isolate of PCV2 (PMWS-PCV-4) that was obtained from the lymph nodes and lung from an 8-week-old pig with PMWS.15 The PCV isolate was characterized genetically as PCV2 by polymerase chain reaction (PCR) using primers designed to detect either PCV118 or PCV2.9

Preparation of PCV2 inoculum

Porcine fetal kidney cells (PFKC) were grown as monolayer cultures using Eagle's minimum essential medium (MEM, Life Technologies, Inc., Grand Island, NY) supplemented with 10% fetal bovine serum (HyClone Laboratories, Inc., Logan, UT) and 50 µg/ml gentamicin. PFKC cells tested negative by PCR for PCV1, PCV2, and PPV and did not develop cytopathic effect before inoculation. No contaminating viruses were identified by transmission electron microscopy. Sections of lymph node and lung from pig PMWS-PCV-4 were homogenized (1 g of tissue was suspended in 5 ml of MEM). The homogenate was sonicated and then centrifuged at 2,450 x g at 4 C for 10 minutes, and the supernatant blindly passaged in PFKC three times before use as inoculum for virus stock preparation. Virus-infected cells were harvested using a cell scraper. In order to release PCV from infected cells, the cells were frozen and thawed three times, sonicated, and then centrifuged at 2,700 x g at 4 C for 10 minutes. The supernatant was collected and further centrifuged at 255,500 x g at 4 C for 2 hours using Beckman SW40 rotor (Palo Alto, CA). The pellet was resuspended in MEM in 1/100 of the starting volume by sonication followed by filtration through a 0.2-µm syringe filter. Aliquots of virus-infected cell extracts used for the inoculum were positive for PCV2 and negative for PPV by PCR. Only PCV particles were identified by transmission electron microscopy in the inoculum. Results of indirect fluorescent antibody tests (IFAs) against pseudorabies virus, porcine rotavirus, swine influenza virus, porcine hemagglutinating encephalomyelitis virus, PPV, or porcine transmissible gastroenteritis virus were negative (data not shown).

Titration of PCV2 inoculum by ELISA

The PCV2 inoculum was titrated by ELISA following a previously described protocol.19 Briefly, 96-well microtiter plates (Becton Dickinson & Co., Franklin Lakes, NJ) were coated with a serially diluted virus preparation at 4 C overnight. After blocking with 1% bovine serum albumin in phosphate-buffered saline (PBS), 100 µl of 1:10,000 diluted anti-PCV2 rabbit serum19 was added into each well and the plate was incubated at 37 C for 2 hours. Subsequently, 100 µl of 1:5,000 diluted horseradish peroxidase–conjugated goat anti-rabbit immunoglobulin G (IgG) (BioRad Laboratories, Hercules, CA) was added into each well as a secondary antibody. The color was developed with O-phenylenediamine substrate. The OD of each well was measured at a dual wavelength of 490 nm and 650 nm using a microplate reader (Molecular Devices, Inc., Sunnyvale, CA). The serum dilution showing an OD reading of at least the mean OD + 2 SD of a negative control was taken as the ELISA virus titer. The PCV2 inoculum titrated by this method had an ELISA virus titer of 1,600.

Animals and husbandry

All BALB/c mice used in this study were purchased from a specific-pathogen–free (SPF) colony (Harlan Sprague-Dawley, Indianapolis, IN). SPF status was verified by serology, bacteriology, parasitology, histopathology, and genetic testing through the supplier and no pathogens were detected (a list of agents the mice were tested for is available through the national customer service center of Harlan Sprague-Dawley). Mice were maintained in isolation rooms in filter-top cages and any handling and husbandry procedures were performed under a laminar flow hood. Care-taking personnel entered the rooms in a specific order to avoid contamination and had to wear different protective clothing in each room. The light cycle in the rooms was 12 hours daily, the room temperature was at 72 ± 2 F (22 ± 1.1 C) and the rooms had humidity in the range of 40–70%. All mice were fed autoclaved Mouse Chow 5010 (Purina Mills, Inc., St. Louis, MO) and autoclaved water; autoclaved CareFRESH (Absorption Corp., Bellingham, WA) was used as bedding. This study met the standards of the Guide for the Care and Use of Laboratory Animals and the study protocol was approved by the Purdue Animal Care and Use Committee (PACUC 98–112).

Experimental design

Forty 8-week-old BALB/c mice were randomly allocated four per filter-top cage into two treatment groups of 16 and 20 mice each and groups were housed in separate isolation rooms. The remaining four mice were euthanatized as day 0 controls. Mice in the group of 16 were sham-inoculated on day 0 with sterile cell culture medium, 0.2 ml intraperitoneally (IP) and 0.02 ml intranasally (IN), and served as negative control (cPCV) mice. Mice in the group of 20 were inoculated in the same manner on day 0 with PCV2 viral inoculum and 16 served as single-inoculated (sPCV) mice. The remaining four mice were similarly inoculated five more times on days 7, 14, 21, 28, and 35 and served as multiple-inoculated (mPCV) mice. Multiple inoculations were performed to investigate the hypothesis that multiple inoculations would increase the number of macrophages susceptible to infection and therefore render the animals susceptible to more severe disease. Four cPCV mice and four sPCV mice were euthanatized 7, 14, 28, and 42 days postinoculation (PI) and all four mPCV mice were sacrificed on day 42 PI.

Fifteen 7-days-pregnant and 12 14-days-pregnant inbred BALB/c mice were placed singly in filter-top cages and randomly allocated into two treatment groups that were placed in separate isolation rooms. Mice in one group, composed of 5 7-day-pregnant and 5 14-day-pregnant mice, were sham-inoculated on day 0 with tissue culture fluid administered as 0.2 ml IP and 0.02 ml IN. Mice in the other group, composed of 10 7-day-pregnant and 7 14-day-pregnant mice, were inoculated in like manner on day 0 with PCV2 viral inoculum. Only one each of the sham-inoculated 7-day-pregnant and 14-day-pregnant mice as well as one each of the PCV-inoculated 7-day-pregnant and 14-day-pregnant mice delivered litters. Three mice from each litter were euthanatized 1, 8, and 15 days after birth.

Necropsy procedure

All mice were euthanatized by anesthetic overdose (90 mg/kg ketamine and 10 mg/kg xylazine) followed by exsanguination by axillary bleeding.

A complete postmortem examination was performed. Samples of spleen were fixed in glutaraldehyde for electron microscopic examination. All detectable lymph nodes, ileum, lung, liver, kidney, stomach, jejunum, cecum, colon, pancreas, heart, skin, brain (cerebellum, cerebrum, brainstem), and tongue were fixed in 10% neutral buffered formalin. These tissues were processed by routine methods and stained with hematoxylin and eosin (HE) for histopathologic examination. Serial sections were stained by in situ hybridization for PCV nucleic acid. Samples of spleen and liver were collected and stored at -80 C for PCR testing for PCV and PPV. In addition, samples of spleen, liver, kidney, and brain were collected and stored frozen at -80 C for further investigations.

In situ hybridization

In situ hybridization for demonstration of PCV nucleic acid by using a PCV-specific oligoprobe was performed as previously described.23 Briefly, a specific oligonucleotide was 3'-end–labeled with digoxigenin (Boehringer Mannheim Biochemica, Indianapolis, IN). After deparaffinization, proteolytic digestion with 0.25% pepsin and prehybridization was done. Hybridization was performed for 5 minutes at 105 C and 60 minutes at 37 C with a probe concentration of 5 µl/1 ml using a microprobe workstation (Fischer Scientific, Pittsburgh, PA). The detection system consisted of the anti-digoxigenin antibody conjugated with alkaline phosphatase (dilution 1:500) and the substrates nitro-blue tetrazolium/5-bromo-4-chloro-3-indolylphosphate (NBT/X-Phos, Boehringer Mannheim Biochemica, Indianapolis, IN). Controls included lymphoid tissue from PCV-infected pigs and sections of spleen and liver from PCV-negative pigs and mice.

Polymerase chain reaction

Samples of spleen and liver from each mouse were pooled and homogenized in equal volumes of 10 mM Tris-HCl plus 1 mM ethylenediaminetetraacetic acid (pH 7.5) using a tissumizer. Total cellular DNA was extracted using a standard protocol.24 A set of PCV2-specific primers (5'ACGCTGAATAATCCTTCC3', 5'CCAACAAAATCTCTATACCC3') were used to amplify PCV sequences by PCR using Vent DNA polymerase (New England Biolab, Inc., Beverly, MA). PCR conditions consisted of an annealing temperature of 56 C for 1 minute, an extension temperature of 74 C for 2 minutes, and a melting temperature of 95 C for detection of PPV; one set of specific primers (5'GCAGTACCAATTCATCTTCT3', 5'TGGTCTCCTTCTGTGGTAGG3') was designed as previously described.13 PCR-amplified DNA samples were analyzed on 1% agarose gel by electrophoresis and the bands of the expected size were visualized by an ultraviolet (UV) transilluminator.

Transmission electron microscopy

Samples of spleen from control and inoculated mice were fixed in 4% glutaraldehyde and postfixed by osmium tetroxide. Tissues were embedded in epon and ultrathin sections were cut and stained with lead citrate and uranyl acetate. Sections were examined and photographed using a Jeol JEM-1000CX transmission electron microscope (JEOL USA, Inc., Peabody, MA).

Serology

Serum collected from sPCV and mPCV mice at necropsy was tested for antibodies to PCV by IFA. PCV1-infected PCNS cells, a primary cell line derived from the brain of a PCV1-infected pig with CT,12 were grown on Teflon-coated dot slides, fixed in acetone for 10 minutes, rinsed with distilled water, and stored at -20 C. Cells were covered with serum from control and principal mice and incubated for 30 minutes in a humidified chamber at 37 C. After incubation, cells were rinsed in PBS and distilled water and air dried. Slides were incubated with fluorescein isothiocyanate–conjugated rabbit anti-mouse IgG (Sigma Immunochemicals, St. Louis, MO) for 30 minutes at 37 C, then rinsed in PBS and water. Slides were cover-slipped using 50% glycerol in PBS. Fluorescence was detected using an epifluorescent UV illumination microscope. All samples were screened at a dilution of 1:8. Those with cells exhibiting typical multifocal perinuclear, nuclear fluorescence, or both for PCV were considered positive for PCV antibodies. Positive serum samples were titrated to determine the level of antibodies.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Validation of control mice

All day 0 control mice and cPCV mice euthanatized on days 7, 14, 28, and 42 PI were negative for PCV by PCR and in situ hybridization and antibodies for PCV were not detected. Sham-inoculated 7-day-pregnant or 14-day-pregnant BALB/c mice and their litters were also negative for PCV by PCR and in situ hybridization. No clinical signs or gross or microscopic lesions were found in day 0 control mice, cPCV mice on days 7, 14, 28, and 42 PI, or newborn mice from sham-inoculated mothers 1, 8, and 15 days after birth.

Serology

Antibodies against PCV were first detected in one of four sPCV mice euthanatized 14 days PI. The detected titer was 1:16. On days 28 and 42 PI, three of four sPCV mice were positive at titers of 1:16 or 1:32. All four mPCV mice were seropositive on day 42 PI with titers of 1:18, 1:32, 1:64 and 1:64.

sPCV and mPCV mice

No clinical signs or gross lesions were observed in sPCV or mPCV mice at any time during the study. PCV was detected in lymphoid organs, liver, and kidney of sPCV mice on days 7, 14, 28, and 42 PI and of mPCV mice on day 42 PI by in situ hybridization and PCR. Microscopic alterations in sPCV mice were first noticed on day 7 PI, were most prominent on days 14 and 28 PI, and were slightly less severe on day 42 PI. The most severe microscopic alterations were found in mPCV mice 42 days PI. Microscopic lesions were limited to lymphoid organs, affecting mainly bronchial and mesenteric lymph nodes, spleen, Peyer's patches, and thymus and were always associated with intralesional PCV-positive cells (Figs. 1–12). The number of PCV-positive cells was proportional to the severity of microscopic alterations, with mPCV mice having the highest number of PCV-positive cells.



View larger version (84K):
[in this window]
[in a new window]
 
Fig. 1. Cervical lymph node from a control BALB/c mouse 28 days PI. No germinal centers are noticeable. HE. Bar = 200 µm.
Fig. 2. Cervical lymph node from a PCV-inoculated BALB/c mouse 28 days PI. Prominent germinal centers occupy most of the parenchyma (arrows). HE. Bar = 200 µm.
Fig. 3. Same germinal center in cervical lymph node as in Fig. 2. Large numbers of apoptotic cells (arrowheads) in germinal centers. HE. Bar = 40 µm.
Fig. 4. Same germinal center in cervical lymph node as in Fig. 2. The cytoplasm of multiple macrophages (arrows) and few nuclei (arrowheads) in the enlarged germinal centers stain dark blue for PCV nucleic acid. In situ hybridization, hematoxylin counterstain. Bar = 40 µm.

 


View larger version (92K):
[in this window]
[in a new window]
 
Fig. 5. Spleen from a control BALB/c mouse 28 days PI. No germinal centers are noticeable. HE. Bar = 200 µm.
Fig. 6. Spleen from a PCV-inoculated BALB/c mouse 28 days PI. Prominent germinal centers (arrows). HE. Bar = 200 µm.
Fig. 7. Same germinal center in spleen as in Fig. 6. Large numbers of apoptotic macrophages (arrowheads) in germinal centers. HE. Bar = 40 µm.
Fig. 8. Same germinal center in spleen as in Fig. 6. The majority of apoptotic macrophages (arrowheads) stain dark blue for PCV nucleic acid. In situ hybridization, hematoxylin counterstain. Bar = 200 µm.

 


View larger version (161K):
[in this window]
[in a new window]
 
Fig. 9. Thymus from a control BALB/c mouse 28 days PI. HE. Bar = 200 µm.
Fig. 10. Thymus from a BALB/c mouse that was inoculated with PCV six times 42 days after the first inoculation. In some lobules the cortex has diffuse depletion of small lymphocytes. HE. Bar = 200 µm.

 


View larger version (142K):
[in this window]
[in a new window]
 
Fig. 11. Liver from a BALB/c mouse that was inoculated with PCV six times 42 days after the first inoculation. Nuclei of multiple hepatocytes stain dark blue for PCV nucleic acid (arrowheads). In situ hybridization, hematoxylin counterstain. Bar = 50 µm.
Fig. 12. Thymus from a PCV-inoculated BALB/c mouse 28 days PI. Multiple lymphocytes randomly distributed throughout the parenchyma have cytoplasmic labeling for PCV nucleic acid (arrowheads). In situ hybridization, hematoxylin counterstain. Bar = 50 µm.

 
In contrast to cPCV mice (Figs. 1, 5), sPCV and mPCV mice developed prominent germinal centers that occupied most of the parenchyma in multiple lymph nodes (Figs. 2–4), Peyer's patches, and the spleen (Figs. 6–8). These enlarged germinal centers consisted of large lymphoblastic cells and histiocytic cells (Figs. 2, 6). Large numbers of histiocytic cells in the germinal centers had microscopic changes typical of apoptosis (Figs. 3, 7). The cytoplasm and less frequently the nuclei of such apoptotic histiocytes were positive for PCV nucleic acid by in situ hybridization (Figs. 4, 8). The paracortex had mild loss of lymphocytes and was infiltrated by large numbers of histiocytes. In addition to the described alterations, mPCV mice had diffuse depletion of small lymphocytes in the thymus on day 42 PI (Fig. 10). PCV nucleic acid was also detected in nuclei of hepatocytes (Fig. 11) and renal tubular epithelial cells and in the cytoplasm of single lymphocytes in the thymus (Fig. 12) in sPCV mice on days 14 and 28 PI and in mPCV mice 42 days PI.

Infection with PCV and apoptosis of infected macrophages was confirmed with transmission electron microscopy on sections of spleen from sPCV mice 28 days PI. Large numbers of histiocytes in germinal centers had nuclear lysis and margination of chromatin aggregates (Fig. 13). Nuclei were often segmented and blebs of nucleolemma contained electron-dense aggregates of chromatin fragments that resembled apoptotic bodies (Fig. 14). The nuclei of multiple apoptotic histiocytes contained centrally located electron-dense inclusions that consisted of viral particles, approximately 10–12 nm in diameter (Fig. 13). Few macrophages had small intracytoplasmic viral inclusions that were composed of loosely aggregated icosahedral viruslike particles, 12 ± 2 nm in diameter, consistent with circoviral particles (Fig. 15). No trilaminar membranes were found surrounding these inclusions.



View larger version (164K):
[in this window]
[in a new window]
 
Fig. 13. Spleen from a PCV-inoculated BALB/c mouse 28 days PI. Macrophage with nuclear lysis and margination of multiple chromatin aggregates and suspected intranuclear viral inclusion (arrows). Uranyl acetate and lead citrate. Bar = 1 µm.
Fig. 14. Same spleen as in Fig. 13. Macrophage with segmented nucleus with multiple marginated electron-dense aggregates of chromatin fragments that resemble apoptotic bodies. Uranyl acetate and lead citrate. Bar = 1 µm.
Fig. 15. Same spleen as in Fig. 13. Small intracytoplasmic circoviral inclusion in macrophage composed of loosely aggregated icosahedral virions, 12 ± 2 nm in diameter. No trilaminar membrane surrounds the inclusion. Uranyl acetate and lead citrate. Bar = 200 nm.

 
Newborn mice

No differences were found in newborn mice whether the mothers had been inoculated at 7 or 14 days of gestation. Newborn mice had difficulties righting themselves during the first 3 days of their lives and were less active than their age-matched uninfected controls. No gross or microscopic lesions were found in newborn mice euthanatized 1 and 8 days after birth. Low amounts of PCV nucleic acid were detected in the liver of all newborn mice within the cytoplasm of few putative Kupffer cells 1 and 8 days after birth. No PCV nucleic acid was detected in other organs including the central nervous system. Newborn mice euthanatized 15 days after birth had similar lesions as sPCV inoculated mice 7 days PI and PCV nucleic acid was detected in similar locations as in sPCV mice.


    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Results of this study demonstrate that PCV2 replicates in BALB/c mice. Replication of PCV2 in BALB/c mice was confirmed by the increasing amount of PCV nucleic acid in a variety of tissues at sequential study days and detection of intranuclear PCV nucleic acid in macrophages, hepatocytes, and renal tubular epithelial cells. The ability of PCV to infect naïve pigs1,2,7,13 and to cross the placenta causing fetal infection in pigs8,11 was previously demonstrated in experimentally infected pigs. This study demonstrates that infection of mice by PCV2 can also occur either directly or transplacentally.

The observed enlargement of germinal centers by infiltration with large numbers of lymphoblastic and histiocytic cells, apoptosis of histiocytes, and mild lymphocytic depletion in the paracortex in PCV2-inoculated mice in this study resembled early lesions 20 days PI in lymph nodes of PCV2-inoculated gnotobiotic pigs.13 However, later lesions observed in PCV2-inoculated pigs 35 days PI were not observed in infected mice, including interstitial pneumonia, hepatitis, nephritis, perivasculitis, multinucleated giant cells, and typical circoviral intracytoplasmic inclusion bodies. The lymphoid lesions in germinal centers of infected mice in this study, termed "complete germinal center structures," are nonspecific alterations that develop in mice after experimental exposure to a number of different antigens.32 Development of complete germinal centers in mice is associated with expression of lymphotoxin-{alpha} in T helper 1 lymphocytes and B lymphocytes, tumor necrosis factor-{alpha}, or other cytokine–receptor interactions.17 Evaluation of cytokine profiles in control and infected mice as well as in vitro studies should elucidate the mechanism of PCV-induced lymphoid lesions.

More severe microscopic lesions in mPCV mice than in sPCV mice are most likely the result of a higher viral dose, but could also be due to an increased number of proliferating macrophages, which have been suggested as the target cells of viral infection, after antigenic stimulation. Although PCV-inoculated mice failed to develop the full range of microscopic lesions associated with PCV infection in pigs, this study demonstrated that mice might serve as a potential reservoir or vector for PCV. Furthermore, this mouse model of PCV2 viral replication with hyperplastic and apoptotic germinal centers will allow studies aimed at determining the role of PCV in induction of apoptosis.

Even though PCV2 infected fetal mice transplacentally and resulted in congenital infection, whether PCV2 caused the impaired mobility in newborn mice observed during the first 3 days after birth is unclear and most affected mice were not euthanatized for several days. Of 18 newborn mice that had problems righting themselves, 6 were euthanatized 1 day after birth. The other 12 mice exhibited normal behavior by 3 days after birth. CT in pigs has been reproduced by inoculation of pregnant sows with PCV8,11,12 and is associated with dysmyelinogenesis22 and PCV infection of neurons in the brain and spinal cord in affected pigs.26 PCV nucleic acid was demonstrated only in putative hepatic Kupffer cells and not in the brain or spinal cord of congenitally PCV2-infected mice. Lesions were not demonstrated in the brain or spinal cord of affected mice by HE staining. No special stains were applied to sections of spinal cord to evaluate for possible dysmyelinogenesis as described in neonatal pigs with CT.22 Although transplacental transmission of PCV was confirmed in mice, the small number of newborn control and PCV infected mice makes further conclusions about this part of the study questionable. More work is needed to determine whether congenital PCV infection of mice results in a model of CT or other disease.

Antibodies against PCV or a closely related circovirus have been demonstrated in mice and febrile human patients.28 The ability of PCV2 to replicate in mice and to cause lesions was confirmed. Whether the circoviral antibodies that were detected in fetal mice were due to PCV1, PCV2 or a closely related species-specific circovirus remains unclear. Whether PCV or a closely related circovirus infects humans also remains unknown. PCV2 has been demonstrated to infect cardiomyocytes and to cause myocardial necrosis in experimentally infected pigs.7,13 Considering the increasing importance of porcine tissues as xenotransplants, especially mitral valves, the potential of PCV to infect humans should be further investigated.


    Acknowledgments
 
We would like to thank D. Vanhorn for electronmicroscopic preparations, G. Sailaja for ELISA, S. Royer for photomicroscopy, and R. Campagnoli for technical advice. We also thank Dr. J. P. Sundberg, The Jackson Laboratory, for assistance with experimental design and critical review of this manuscript.


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Allan GM, Kennedy S, McNeilly F, Foster JC, Ellis JA, Krakowka SJ, Meehan BM, Adair B: Experimental reproduction of severe wasting disease by co-infection of pigs with porcine circovirus and porcine parvovirus. J Comp Pathol 121:1-11, 1999[CrossRef][Medline]
  2. Allan GM, McNeilly F, Cassidy JP, Reilly GAC, Adair B, Ellis WA, McNulty MS: Pathogenesis of porcine circovirus; experimental infections of colostrum deprived piglets and examination of pig foetal material. Vet Microbiol 44:49-64, 1995[CrossRef][Medline]
  3. Allan GM, McNeilly F, Kennedy S, Daft B, Clarke EG, Ellis JA, Haines DM, Meehan BM, Adair B: Isolation of porcine circovirus-like viruses from pigs with a wasting disease in the USA and Europe. J Vet Diagn Invest 10:3-10, 1998[Abstract/Free Full Text]
  4. Clark EG: Post-weaning multisystemic wasting syndrome. Proc Annu Meet Am Assoc Swine Pract 28:499-501, 1997
  5. Daft B, Nordhausen RW, Latimer KS, Niagro FD: Interstitial pneumonia and lymphadenopathy associated with circoviral infection in a six-week-old pig. Proc Annu Meet Am Assoc Vet Lab Diagn 39:32, 1996
  6. Ellis J, Hassard L, Clark E, Harding J, Allan G, Willson P, Strokappe J, Martin K, McNeilly F, Mehan B, Todd D, Haines D: Isolation of circovirus from lesions of pigs with postweaning multisystemic wasting syndrome. Can Vet J 39:44-51, 1998[Medline]
  7. Ellis J, Krakowka S, Lairmore M, Haines D, Bratanich A, Clark E, Allan G, Konoby C, Hassard L, Meehan B, Martin K, Harding J, Kennedy S, McNeilly F: Reproduction of lesions of postweaning multisystemic wasting syndrome in gnotobiotic pigs. J Vet Diagn Invest 11:3-14, 1999[Abstract/Free Full Text]
  8. Gustafson DP, Kanitz CL: Experimental transmission of congenital tremors in swine. US Anim Hosp Assoc 78:338-345, 1974
  9. Hamel AL, Lin LL, Nayar GPS: Nucleotide sequence of porcine circovirus associated with postweaning multisystemic wasting syndrome in pigs. J Virol 72:5262-5267, 1998[Abstract/Free Full Text]
  10. Harding JCS, Clark EG: Recognizing and diagnosing postweaning multisystemic wasting syndrome (PMWS). Swine Health Prod 5:201-203, 1997
  11. Hines RK: Porcine circovirus causes congenital tremors type A-II proved by fulfilling Koch's postulates. PhD Diss., University of Georgia, Athens, GA 1994
  12. Kanitz CL: Myoclonia congenita: studies of the resistance to viral infection of tissue culture cell lines derived from myclonic pigs. PhD Diss., Purdue University, West Lafayette, IN 1972
  13. Kiupel M, Stevenson GW, Choi J, Latimer KS, Kanitz CL, Mittal SK: Production of clinical disease and lesions typical of postweaning multisystemic wasting syndrome (PMWS) in experimentally inoculated gnotobiotic pigs. J Vet Diagn Invest (in press)
  14. Kiupel M, Stevenson GW, Kanitz CL, Anothayanontha L, Latimer KS, Mittal SK: Cellular localization of porcine circovirus in postweaning pigs with chronic wasting disease. Eur J Vet Pathol 5:45-50, 1999
  15. Kiupel M, Stevenson GW, Mittal SK, Clark EG, Haines DM: Circovirus-like viral associated disease in weaned pigs in Indiana. Vet Pathol 35:303-307, 1998[Abstract]
  16. LeCann PE, Albina F, Madec R: Piglet wasting disease. Vet Rec 141:660, 1997[Medline]
  17. Matsumoto M, Mariathasan S, Nahm MH, Baranyay F, Peschon JJ, Chaplin DD: Role of lymphotoxin and type 1 TNF receptor in the formation of germinal centers. Science 271:1289-1291, 1996[Abstract]
  18. Meehan BM, Creelan JL, McNulty MS, Todd D: Sequence of porcine circovirus DNA: affinities with plant circoviruses. J Gen Virol 78:221-227, 1997[Abstract]
  19. Mittal SK, Middleton DM, Tikoo SK, Babiuk LA: Pathogenesis and immunogenicity of bovine adenovirus type 3 in cotton rats (Sigmodon hispidus). Virology 213:(1) 131-139, 1995[CrossRef][Medline]
  20. Morozov I, Sirinarumitr T, Sorden SD, Halbur PG, Morgan MK, Yoon KJ, Paul PS: Detection of a novel strain of porcine circovirus in pigs with postweaning multisystemic wasting syndrome. J Clin Microbiol 36:2535-2541, 1998[Abstract/Free Full Text]
  21. Nayar GP, Hamel SA, Lin L: Detection and characterization of porcine circovirus associated with post-weaning multisystemic wasting syndrome in pigs. Can Vet J 38:385-386, 1997[Medline]
  22. Patterson DSP, Done JT, Foulkes JA, Sweasey D: Neurochemistry of the spinal cord in congenital tremor of piglets (type A2), a spinal dysmyelimogenesis of infectious origin. J Neurochem 26:481-485, 1976[CrossRef][Medline]
  23. Rosell C, Segales J, Plana-Duran J, Balasch M, Rodriguez-Arrioja GM, Kennedy S, Allan GM, McNeilly F, Latimer KS, Domingo M: Pathological, immunohistochemical, and in-situ hybridization studies of natural cases of postweaning multisystemic wasting syndrome (PMWS) in pigs. J Comp Pathol 120:59-78, 1999[CrossRef][Medline]
  24. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning: A Laboratory Manual 9.14–9.23. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 1998
  25. Segales JM, Sitjar M, Domingo S: First report of post-weaning syndrome in piglets in Spain. Vet Rec 141:600-601, 1997[Free Full Text]
  26. Stevenson GW, Kiupel M, Mittal SK, Choi J, Latimer KS, Kanitz CL: Tissue distribution and genetic typing of porcine circoviruses in pigs with naturally occurring congenital tremors. J Vet Diagn Invest (in press)
  27. Stevenson GW, Kiupel M, Mittal SK, Kanitz CL: Ultrastructure of porcine circovirus in persistently infected PK-15 cells. Vet Pathol 36:368-378, 1999[Abstract]
  28. Tischer I, Bode L, Apodaca J, Timm H, Peters D, Rasch R, Pociuli S, Gerike E: Presence of antibodies reacting with porcine circovirus in sera of humans, mice and cattle. Arch Virol 140:1427-1439, 1995[CrossRef][Medline]
  29. Tischer I, Gelderblom H, Vettermann W, Koch MA: A very small porcine virus with circular single-stranded DNA. Nature 295:64-66, 1982[CrossRef][Medline]
  30. Tischer I, Mields W, Wolff D, Vagt M, Griem W: Studies on epidemiology and pathogenity of porcine circovirus. Arch Virol 91:271-276, 1986[CrossRef][Medline]
  31. Tischer I, Rasch R, Tochtermann G: Characterization of papovavirus and picornavirus-like particles in permanent pig kidney cell lines. Zentralbl Bakteriol Hyg A 226:153-167, 1974
  32. Tsiagbe VK, Inghirami G, Thorbecke GJ: The physiology of germinal centers. Crit Rev Immunol 16:381-421, 1996[Medline]
Request reprints from Dr. M. Kiupel, Animal Disease Diagnostic Laboratory, Purdue University, West Lafayette, IN 47906-1175 (USA). E-mail: tomcat{at}purdue.edu.


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Vet PatholHome page
C. Rodriguez-Carino and J. Segales
Ultrastructural Findings in Lymph Nodes from Pigs Suffering from Naturally Occurring Postweaning Multisystemic Wasting Syndrome
Vet. Pathol., July 1, 2009; 46(4): 729 - 735.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
H.-G. Shen, J.-Y. Zhou, Z.-Y. Huang, J.-Q. Guo, G. Xing, J.-L. He, Y. Yan, and L.-Y. Gong
Protective immunity against porcine circovirus 2 by vaccination with ORF2-based DNA and subunit vaccines in mice
J. Gen. Virol., August 1, 2008; 89(8): 1857 - 1865.
[Abstract] [Full Text] [PDF]


Home page
Vet PatholHome page
L. Mandrioli, G. Sarli, M. Zengarini, S. Panarese, and P. S. Marcato
Immunohistochemical MHC-II and Interleukin 2-R (CD25) Expression in Lymph Nodes of Pigs with Spontaneous Postweaning Multisystemic Wasting Syndrome (PMWS).
Vet. Pathol., November 1, 2006; 43(6): 993 - 997.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. Liu, I. Chen, Q. Du, H. Chua, and J. Kwang
The ORF3 Protein of Porcine Circovirus Type 2 Is Involved in Viral Pathogenesis In Vivo.
J. Virol., May 1, 2006; 80(10): 5065 - 5073.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. Liu, I. Chen, and J. Kwang
Characterization of a Previously Unidentified Viral Protein in Porcine Circovirus Type 2-Infected Cells and Its Role in Virus-Induced Apoptosis
J. Virol., July 1, 2005; 79(13): 8262 - 8274.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
M. Fenaux, T. Opriessnig, P. G. Halbur, Y. Xu, B. Potts, and X.-J. Meng
Detection and in vitro and in vivo characterization of porcine circovirus DNA from a porcine-derived commercial pepsin product
J. Gen. Virol., November 1, 2004; 85(11): 3377 - 3382.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
I. E. Vincent, C. P. Carrasco, B. Herrmann, B. M. Meehan, G. M. Allan, A. Summerfield, and K. C. McCullough
Dendritic Cells Harbor Infectious Porcine Circovirus Type 2 in the Absence of Apparent Cell Modulation or Replication of the Virus
J. Virol., December 15, 2003; 77(24): 13288 - 13300.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kiupel, M.
Right arrow Articles by Mittal, S. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kiupel, M.
Right arrow Articles by Mittal, S. K.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS