Vet Pathol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Uhl, E. W.
Right arrow Articles by Hodge, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Uhl, E. W.
Right arrow Articles by Hodge, T.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Vet Pathol 39:132-136 (2002)
© 2002 American College of Veterinary Pathologists


BRIEF COMMUNICATIONS AND CASE REPORTS

Increased Pulmonary Activation of Nuclear Factor-{kappa}B (NF-{kappa}B) in Foals Inoculated with Rhodococcus equi is Associated with Increased Expression of Inflammatory Cytokines

E. W. Uhl, S. Giguère, T. J. Jack and T. Hodge

Abstract

Previous studies revealed that foals inoculated with virulent Rhodococcus equi had significantly higher pulmonary levels of interleukin-1ß, interleukin-12 p40, interferon-{gamma}, and tumor necrosis factor-{alpha} mRNA compared to foals inoculated with an avirulent plasmid-cured derivative. The purpose of this study was to determine if the increases in cytokine expression were associated with increased pulmonary activation of nuclear factor-{kappa}B (NF-{kappa}B). Electrophoretic mobility shift assays were performed on pulmonary nuclear protein extracted from foals treated with phosphate-buffered saline, or inoculated with either virulent or avirulent R. equi. NF-{kappa}B activation was increased in the nuclear extracts from foals inoculated with virulent R. equi at 14 days after inoculation when increased cytokine expression was also observed. Southwestern histochemistry revealed activated NF-{kappa}B in multinucleated giant cells that often contained bacteria. These results indicate that the cytokine response to R. equi is at least partially mediated by NF-{kappa}B activation.


Key words: Nuclear factor-{kappa}B; Rhodococcus equi.

Rhodococcus equi, a facultative intracellular pathogen of macrophages, is one of the most important causes of respiratory disease in foals between the ages of 1 and 5 months. R. equi is widespread in the environment, with isolates from pneumonic foals typically containing an 85- to 90-kilobase plasmid encoding a family of seven closely related virulence-associated proteins.8,16,17 Plasmid-cured derivatives of virulent R. equi strains lose the ability to replicate and survive in macrophages and fail to induce pneumonia in foals.8,9 The pulmonary cytokine responses associated with development of the typical granulomatous pneumonia induced in foals by R. equi have been characterized using wild-type and avirulent, plasmid-cured derivatives of R. equi.9,10 Infection with virulent versus avirulent R. equi induces increased interleukin-1ß (IL-1ß), tumor necrosis factor-{alpha} (TNF-{alpha}), and IL-12 p40 mRNA expression in lung tissue 3 and 14 days after inoculation. Increased interferon-{gamma} (IFN-{gamma}) mRNA expression was only detected at 14 days after inoculation.10 All of these inflammatory mediators are at least partially regulated by the transcription factor nuclear factor-{kappa}B (NF-{kappa}B).2

NF-{kappa}B is a critical regulator of cytokine-mediated inflammation. It is sequestered in the cytoplasm of most cells and is activated by a series of events involving signaled phosphorylation, ubiquitination, and proteolysis of its inhibitor, I{kappa}B.2,4 Degradation of I{kappa}B exposes a nuclear localization signal on NF-{kappa}B, which allows it to move into the nucleus, bind DNA, and induce gene transcription.2 NF-{kappa}B regulates the transcription of many genes encoding inflammatory mediators, and induction of many NF-{kappa}B-regulated mediators is an important component of the both the innate and acquired immune response. Activation of NF-{kappa}B can be directly stimulated by a wide range of bacterial, protozoal, and viral pathogens, including Bordetella pertussis,1 Borrelia burgdorferi,5 enteroinvasive bacteria,6 Trypanosoma cruzi,11 Toxoplasma gondii,3 rhinovirus,15 and respiratory syncycial virus.7 Although NF-{kappa}B activation may be critical to resistance or clearance of infection, NF-{kappa}B activation also contributes to tissue damage, and inappropriate activation of NF-{kappa}B has been implicated in the pathogenesis of several respiratory diseases.2 The purpose of this study was to determine if the increases in pulmonary expression of inflammatory cytokines were associated with increased pulmonary activation of NF-{kappa}B.

Eighteen healthy, 3-week-old mixed-breed pony foals were used in this study, which was performed in conjunction with other studies on the role of the large plasmid in the virulence of,8 and cytokine induction by, R. equi.10 Foals were randomly assigned to treatment groups, and those inoculated with R. equi received 2.5 x 109 colony-forming units suspended in phosphate-buffered saline (PBS) intrabronchially. Six foals were inoculated with the virulent plasmid-containing strain (103+), six were inoculated with the avirulent, plasmid-cured derivative (103-), and six foals received only PBS. Half of the foals from each group were euthanatized 3 days after inoculation and the other half were sacrificed at 14 days after inoculation. All organs were examined grossly and representative tissue samples were cultured, whereas others were fixed in formalin and examined histologically. Samples of lung tissue were frozen in liquid nitrogen and stored at -80 C until processed. Pulmonary cytokine mRNA expression was previously determined on the same samples used in the electrophoretic mobility shift assays (EMSAs).

NF-{kappa}B activation was assessed by comparing the level of DNA binding in pulmonary nuclear extracts from the foals by means of EMSAs. Nuclear protein was extracted from lung tissue and EMSAs were performed as previously described.14 The fractionated nuclear extract (20 µg total protein) was incubated (20 minutes, 25 C) with double-stranded oligonucleotides, encoding the target sequence NF-{kappa}B, (AGTTGAGGGACTTTCCCAGGC), end labeled with [gamma-32P] adenosine triphosphate and T4 polynucleotide kinase (0.1–0.5 ng; 20,000–100,000 counts per minute). Protein–DNA binding complexes were resolved on a 6% polyacrylamide gel with 0.1 x TAE (Tris–acetic acid–ethylenediaminetetraacetic acid [EDTA]) running buffer. Specificity was determined by addition of excess unlabeled double-stranded oligonucleotides, or by use of a probe with a mutated NF-{kappa}B binding site (AGTTGAGCTCCTTTCCCAGGC). The retarded bands were detected by autoradiography. Optical band densities of shifted target bands of samples run on the same gel were compared. Mean values between groups were compared by one-way analysis of variance with a microcomputer-based statistical program (SigmaStat, Jandel Corporation, San Rafael, CA). Differences between individual means were assessed by Bonferroni's method of all pairwise multiple comparison.

Southwestern in situ histochemistry (SWISH) was performed to identify cells with activated NF-{kappa}B in formalin-fixed, paraffin-embedded tissue sections. The protocol was modified from that described previously.12 In brief, 4-µm sections of lung tissue were deparaffined, rehydrated, incubated in 2 mM levamisole for 15 minutes at room temperature, post fixed in 0.2% paraformaldehyde for 30 minutes at room temperature, and pretreated with pepsin A (433 U/mg, Sigma, St. Louis, MO) in 1 N HCl for 30 minutes at 37 C. After two washes in HEPES-bovine serum albumin (BSA) buffer, the sections were incubated in 0.4 mg/ml DNAse I in HEPES-BSA for 30 minutes at 30 C, and washed twice in HEPES-EDTA. Prehybridization in probe buffer for 30 minutes was followed by incubation with a digoxigenin-labeled double-stranded DNA binding site for NF-{kappa}B at 37 C overnight in a humidified box. Detection was performed by incubating the sections with anti-digoxigenin antibody conjugated with alkaline phosphatase (1:250 in blocking solution; Roche molecular Biochemicals, Indianapolis, IN) overnight at 4 C, followed by incubation in detecting solution in the dark at 37 C for 30 minutes as previously described.12 Sections were then dehydrated, counterstained with eosin, and mounted in Permount (Fisher Scientific, Pittsburgh, PA). Specificity of the binding was determined by comparing the staining to that present in serial sections incubated with a digoxigenin-labeled double-stranded DNA probe containing a mutated NF-{kappa}B binding site. Comparisons were also made between these sections and lung sections stained with hematoxylin and eosin, and Gram's stain (Brown and Brenn).13 Cell types were identified based upon histologic appearance.

The complete clinicopathologic description and cytokine mRNA expression of the foals in this study has been reported elsewhere.8,10 As indicated by the increased densities of the shifted bands, foals infected with virulent (103+) R. equi had increased pulmonary activation of NF-{kappa}B at 14 days after inoculation compared to foals inoculated with PBS or avirulent (103-) R. equi (Fig. 1, 2). At 3 days after inoculation, NF-{kappa}B band densities were slightly, but not significantly increased in the nuclear protein extracts from foals inoculated with virulent (103+) R. equi (Fig. 1). SWISH for NF-{kappa}B, with the same DNA probe utilized in the EMSA, was performed on lung sections taken from foals 14 days after inoculation (Fig. 3). Positive nuclear staining for activated NF-{kappa}B was most pronounced at the edges of pyogranulomatous lesions. In these areas, roughly 40% of epithelial cells, 30% of macrophages, and 60% of giant cells (Fig. 3b) were stained. Many of the multinucleated giant cells also contained Gram's stain–positive bacteria compatible with R. equi (Fig. 3d).



View larger version (58K):
[in this window]
[in a new window]
 
Fig. 1. Representative electrophoretic mobility shift assays (EMSAs) for nuclear factor-{kappa}B (NF-{kappa}B) performed on pulmonary nuclear protein extracted from foals. Each lane was loaded with 20 µg of pulmonary nuclear protein that had been extracted from individual foals and incubated with radiolabeled double-stranded oligonucleotides encoding the NF-{kappa}B binding sequence. Increased activation of NF-{kappa}B, as indicated by the increased DNA binding, was present in the samples from foals 14 days after inoculation with virulent (103+) Rhodococcus equi compared to samples from foals inoculated with saline (control) or avirulent (103-) R. equi. Positive and negative controls for the NF-{kappa}B EMSAs are shown in the small panel. The positive control (+) sample was pulmonary nuclear protein extracted from a rat inoculated with Sendai virus, which is known to directly activate NF-{kappa}B. Dense shifted bands, similar to those observed in the foals inoculated with the virulent (103+) form of R. equi, were present. DNA binding was not observed in samples that were either incubated with radiolabeled DNA coding for a mutated NF-{kappa}B binding site (Mut), or incubated with unlabeled DNA coding for the NF-{kappa}B binding site before incubation with the labeled DNA (cold).

 


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 2. The relative optical densities of the shifted bands were compared between samples taken from all three groups at both 3 and 14 days after inoculation. Compared to those of all the other groups, the band densities in the samples taken from foals 14 days after they were inoculated with the virulent (103+) form of Rhodococcus equi were significantly increased. Nuclear protein from three animals per group was analyzed. Multiple gels were run to confirm the results and band density comparisons were only made on samples run on the same gel.

 


View larger version (162K):
[in this window]
[in a new window]
 
Fig. 3. Lung; foal. Lung tissue sections from a foal inoculated with the virulent (103+) form of Rhodococcus equi 14 days before sampling. Nuclear staining for nuclear factor-{kappa}B (NF-{kappa}B) was detected in multinucleated giant cells by southwestern in situ histochemistry. Fig. 3a. Sections were incubated with digoxigenin-labeled, double-stranded DNA probes coding for a mutated (AGTTGAGCTCCTTTCCCAGGC) NF-{kappa}B binding site. Fig. 3b. Sections were incubated with digoxigenin-labeled, double-stranded DNA probes coding for an intact (AGTTGAGGGACTTTCCCAGGC) NF-{kappa}B binding site. Labeled cells were detected by immunohistochemical staining for digoxigenin and the sections were counterstained with eosin. Fig. 3c. A hematoxylin and eosin–stained multinucleated giant cell. Fig. 3d. Gram's stain–positive bacteria compatible with R. equi were identified within the giant cells by Brown and Brenn tissue Gram's staining. Bar = 10 µm.

 
One advantage of SWISH over immunohistochemistry is that SWISH detects all forms of NF-{kappa}B binding to the -{kappa}B target DNA sequence as opposed to only those containing the NF-{kappa}B subunit targeted by an antibody. A second advantage is that SWISH detects NF-{kappa}B that is able to bind DNA, an indication that the NF-{kappa}B is activated, rather than simply detecting the presence of the subunit proteins. However, some of the active NF-{kappa}B protein most likely was denatured in tissue processing, and, therefore, the technique probably underestimated the number of cells with activated NF-{kappa}B.

Previous studies demonstrated increased pulmonary expression of the proinflammatory cytokines IL-1ß, TNF-{alpha}, IL-12 p40, and IFN-{gamma} in foals with R. equi-induced pneumonia.9 NF-{kappa}B is known to up-regulate gene expression of all of these cytokines in a variety of species.2,4 Increased pulmonary activation of NF-{kappa}B was associated with increased cytokine expression at 14 days after inoculation. Although a slight trend toward increased activation was observed, NF-{kappa}B activation was not significantly increased in foals inoculated with either the avirulent or the virulent forms of R. equi at 3 days after inoculation, even though increases in cytokine mRNA were observed at this time point.10 Day 3 is early in the infection and increased NF-{kappa}B activation may not have been detected if the activation was occurring in a localized area of the lung and the assays of whole lung tissue were not sensitive enough to detect this increase. Alternatively, differentially regulated acute and chronic activation of NF-{kappa}B has been described in models of endotoxemia,18 and the 3-day time point may be within a transition phase between the acute activation of NF-{kappa}B, stimulated by the initial bacterial infection, and the chronic phase of NF-{kappa}B activation induced by the persistence of infection.

The observation that NF-{kappa}B was activated in multinucleated giant cells, many of which commonly contained Gram's stain–positive bacteria, indicates that R. equi could be directly activating NF-{kappa}B. This conclusion is consistent with the results of a previous study that documented that R. equi could directly up-regulate cytokine expression in murine macrophages.9 NF-{kappa}B activation is also enhanced by many inflammatory mediators, including TNF-{alpha} and IL-1ß,2 that are present in the chronic inflammatory lesions typical of R. equi pneumonia.

Activation of NF-{kappa}B has been demonstrated to be critical to the innate and adaptive immune response to a variety of infectious agents; however, its role can be very complex. For example, both cell-specific activation of NF-{kappa}B and the presence of specific NF-{kappa}B subunits have been shown to be critical to resistance to parasitic infections.3,11 Given the evidence that abnormal NF-{kappa}B signaling results in an impaired ability to respond to a variety of infectious agents, foals susceptible to the development of severe R. equi pneumonia possibly could have defects in NF-{kappa}B signaling. Further studies are needed to address this possibility.

The results of this study indicate that one potential mechanism by which virulent R. equi modulates pulmonary expression of inflammatory cytokines is through increased activation of NF-{kappa}B, and that some of this increase may be a direct effect of bacterial infection.

Acknowledgments

This study was supported in part by a grant from the State of Florida's Pari-mutuel Wagering Trust Fund.

References

  1. Belcher CE, Drenkow J, Kehoe B, Gingeras TR, McNamara N, Lemjabbar H, Basbaum C, Relman DA: The transcriptional responses of respiratory epithelial cells to Bordetella pertussis reveal host defensive and pathogen counter-defensive strategies. Proc Natl Acad Sci USA 97:13847-13852, 2000[Abstract/Free Full Text]
  2. Blackwell TS, Christman JW: The role of nuclear factor-{kappa}B in cytokine gene regulation. Am J Respir Cell Mol Biol 17:3-9, 1997[Abstract/Free Full Text]
  3. Caamaño J, Alexander J, Craig L, Bravo R, Hunter CA: The NF-{kappa}B family member RelB is required for innate and adaptive immunity to Toxoplasma gondii. J Immunol 163:4453-4461, 1999[Abstract/Free Full Text]
  4. Chen F, Castranova V, Shi X, Demers L: New insights into the role of nuclear factor-{kappa}B, a ubiquitous transcription factor in the initiation of diseases. Clin Chem 45:7-17, 1999[Abstract/Free Full Text]
  5. Ebnet K, Brown KD, Siebenlist UK, Simon MM, Shaw S: Borrelia burgdorferi activates nuclear factor-kappaB and is a potent inducer of chemokine and adhesion molecule gene expression in endothelial cells and fibroblasts. J Immunol 158:3285-3292, 1997[Abstract]
  6. Elewaut D, DiDonato JA, Kim JM, Truong F, Eckmann L, Kagnoff MF: NF-{kappa}B is a central regulator of the intestinal epithelial cell innate immune response induced by infection with enteroinvasive bacteria. J Immunol 163:1457-1466, 1999[Abstract/Free Full Text]
  7. Garofalo R, Sabry M, Jamaluddin M, Yu RK, Casola A, Ogra PL, Brasier AR: Transcriptional activation of the interleukin-8 gene by respiratory syncytial virus infection in alveolar epithelial cells: nuclear translocation of the RelA transcription factor as a mechanism producing airway mucosal inflammation. J Virol 12:8773-8781, 1996
  8. Giguère S, Hondalus MK, Yager JA, Darrah P, Mosser DM, Prescott JF: Role of the 85-kilobase plasmid and plasmid-encoded virulence-associated protein A in intracellular survival and virulence of Rhodococcus equi. Infect Immun 67:3548-3557, 1999[Abstract/Free Full Text]
  9. Giguère S, Prescott JF: Cytokine induction in murine macrophages infected with virulent and avirulent Rhodococcus equi. Infect Immun 6:1848-1854, 1998
  10. Giguère S, Wilkie BN, Prescott JF: Modulation of cytokine response of pneumonic foals by virulent Rhodococcus equi. Infect Immun 67:5041-5047, 1999[Abstract/Free Full Text]
  11. Hall BS, Tam W, Sen R, Pereira EA: Cell-specific activation of nuclear factor-{kappa}B by the parasite Typanosoma cruzi promotes resistance to intracellular infection. Mol Biol Cell 11:153-160, 2000[Abstract/Free Full Text]
  12. Herandez-Presa M, Gomez-Guerrero C, Egido J: In situ non-radioactive detection of nuclear factors in paraffin sections by southwestern histochemistry. Kidney Int 55:209-214, 1999[CrossRef][Medline]
  13. Humason GL: Animal Tissue Techniques, 4th ed. pp 353-354, WH Freeman and Co, San Francisco, CA 1979
  14. Lui SF, Haddad EB, Adcock IM, Salmon M, Koto H, Gilbey T, Barnes PJ, Chung KF: Inducible nitric oxide synthase after sensitization and allergen challenge of brown Norway rat lung. Br J Pharmacol 121:1241-1246, 1997[CrossRef][Medline]
  15. Papi A, Johnson SL: Rhinovirus infection induces expression of its own receptor intercellular adhesion molecule 1 (ICAM-1) via increased NF-{kappa}B-mediated transcription. J Biol Chem 274:9707-9720, 1999[Abstract/Free Full Text]
  16. Taka S, Hines SA, Sekizaki T, Nicholson VM, Alperin DA, Osaki M, Takamatsu D, Nakamura M, Suzuki K, Ogino N, Kakuda T, Dan H, Prescott JF: DNA sequence and comparison of virulence plasmids from Rhodococcus equi ATCC 33701 and 103. Infect Immun 68:6840-6847, 2000[Abstract/Free Full Text]
  17. Taka S, Watanabe Y, Ikeda T, Ozawa T, Matsukura S, Tamada Y, Tsubaki S, Sekizaki T: Virulence-associated plasmids in Rhodococcus equi. J Clin Microbiol 31:1726-1729, 1993[Abstract/Free Full Text]
  18. Thompson JE, Phillips RJ, Erdjument-Bromage H, Tempst P, Ghosh S: I{kappa}B-ß regulates the persistent response in a biphasic activation of NF-{kappa}B. Cell 80:573-582, 1995[CrossRef][Medline]
Request reprints from Dr. E. W. Uhl, Department of Pathobiology, College of Veterinary Medicine, Box 100145, University of Florida, Gainesville, FL 32610-0145 (USA). E-mail: uhle{at}mail.vetmed.ufl.edu.


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
CVIHome page
M. J. B. F. Flaminio, D. V. Nydam, H. Marquis, M. B. Matychak, and S. Giguere
Foal Monocyte-Derived Dendritic Cells Become Activated upon Rhodococcus equi Infection
Clin. Vaccine Immunol., February 1, 2009; 16(2): 176 - 183.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Uhl, E. W.
Right arrow Articles by Hodge, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Uhl, E. W.
Right arrow Articles by Hodge, T.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS