Vet Pathol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Levine, R. A.
Right arrow Articles by Smith, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Levine, R. A.
Right arrow Articles by Smith, C.
Vet Pathol 39:372-378 (2002)
© 2002 American College of Veterinary Pathologists

Tumor Suppressor PTEN is Mutated in Canine Osteosarcoma Cell Lines and Tumors

R. A. Levine, T. Forest and C. Smith

Departments of Molecular Medicine (RAL) and Biomedical Sciences (TF, CS), College of Veterinary Medicine, Cornell University, Ithaca, NY


   Abstract
Top
 Abstract
Materials and Methods
 Results
 Discussion
 References
 
Canine osteosarcoma (OS) cell lines contain mutations that directly or indirectly inactivate the tumor suppressor genes p53 and retinoblastoma. Another important tumor suppressor, PTEN, is mutated in many human cancers. To determine whether inactivation of PTEN plays a role in the pathogenesis of canine OS, we studied its expression in canine OS cell lines and tumors. Four of five canine OS cell lines (CO2, CO3, CO5, and CO7) constitutively express high levels of the phosphorylated form of Akt, an indirect indicator of aberrant PTEN expression. PTEN protein is essentially absent from three of these cell lines (CO2, CO5, and CO7), whereas CO3 contains a potentially inactivating amino acid substitution in PTEN at codon 340. Genomic hybridization experiments indicate that CO2, CO5, and CO7 contain large deletions within the PTEN gene. Ten of 15 OS tumors exhibit variable or negative PTEN staining. Evaluation of a PTEN-negative staining tumor by Southern blotting indicates that the PTEN gene is deleted in this tumor. These results indicate that PTEN is mutated or downregulated in a high percentage of canine OS cell lines and tumors and likely plays an important role in the pathogenesis of the disease.

Key words: Bone neoplasia; dogs; osteosarcoma; PTEN; tumorigenesis; tumor suppressor.

Canine osteosarcoma (OS) is a prevalent, highly metastatic tumor, occurring primarily in large and giant breeds. Although canine and human OS are histologically similar, tumor prevalence and age of occurrence are dissimilar.24,31,39 Similarities and differences also exist at the molecular level. We and others have shown that canine OS cell lines and tumors, like their human counterparts, frequently contain mutations that inactivate p53.17,19,23,40 However, whereas a high percentage of human OS cell lines and tumors contain mutations that block retinoblastoma (Rb) mRNA accumulation, protein expression, or both, little evidence of similar inactivating mutations has been found in canine OS cell lines or tumors.23 Instead, canine OS cell lines contain mutations that indirectly inactivate the three Rb family members, Rb, p107, and p130, simultaneously.19

The tumor suppressor gene, PTEN, encodes a dual specificity protein–lipid phosphatase that plays an important role in regulating cell proliferation, migration, and survival, as well as tumor cell invasion and tumor-directed angiogenesis.1,5,7,10,37 The lipid phosphatase activity of PTEN plays a crucial role in mediating the tumor suppressive effects of PTEN by downregulating phosphatidylinositol 3,4-bisphosphate and phosphatidyl-inositol 3,4,5-trisphosphate (PIP3) levels within the cell.11,21,27 PIP3 activates phosphoinositol-dependent kinase-1 (PDK-1), which in turn activates by phosphorylation several important protein kinases that stimulate cellular proliferation and enhance cell survival. Most notably, the PDK-1 substrate Akt blocks apoptosis by inactivating proapoptotic proteins BAD, FKHR, and caspase-9.4,6,8,9 In addition, Akt stabilizes hypoxia-inducible factor 1-{alpha}, thereby stimulating VEGF-mediated angiogenesis.45 PTEN has also been shown to inhibit cell proliferation, migration, and tumor cell invasion by associating with and dephosphorylating focal adhesion kinase.35–37

PTEN is mutated in a wide range of human tumors, including carcinomas of the endometrium, prostate, kidney, and breast, as well as in glioblastomas.2 PTEN loss of heterozygosity frequently is observed in melanoma cell lines and tumors.14,38 Germline mutations of PTEN are associated with several autosomal dominant disorders, most notably Cowden disease.2,20,28 To our knowledge, PTEN mutations have not been identified in human OS. We examined the expression and genomic integrity of PTEN in several canine OS cell lines and tumors. Our results indicate that aberrant expression of PTEN in canine OS cell lines and tumors can at least in part be explained by mutations in the PTEN gene.


   Materials and Methods
Top
 Abstract
 Materials and Methods
Results
 Discussion
 References
 
Osteosarcoma cell lines and tumors

The isolation and maintenance of canine OS cell lines CO2, CO3, CO5, CO7, and CO8 have been described previously.19 Formalin-fixed paraffin-embedded OS tissues were obtained from the collection of specimens kept by the Cornell University College of Veterinary Medicine Section of Pathology. Individual tumor samples are described in Table 1.


View this table:
[in this window]
[in a new window]
  		Table 1. Selected characteristics of canine osteosarcoma cases.

 
Antibodies and cloned DNAs

PTEN antibody (A2B1) was obtained from Santa Cruz Biotechnology Inc. (Santa Cruz, CA). Akt (9272) and phospho-Akt (Ser 473, 9271S) antibodies were obtained from New England Biolabs (Beverley, MA). DNA probes for full-length murine PTEN were obtained from Dr. J. Guan (Department of Molecular Medicine, Cornell University, Ithaca, NY). A DNA probe for Jnk 1 was obtained by polymerase chain reaction (PCR) with oligonucleotides (forward primer CATGAGCAGAAGCAAACGTG starting at nucleotide 24 and reverse primer ATTGATCATTGCTGCACCTGTG ending at nucleotide 1164) derived from murine Jnk 1 cDNA published sequences (GenBank accession No. AB005663).

DNA analysis

DNA was extracted from cells in culture or freshly frozen tissue samples by lysis in 100 mM NaCl, 10 mM Tris 8.0, 25 mM, ethylenediametetraacetic acid, 0.5% sodium dodecyl sulfate (SDS), and 100 µg/ml proteinase K at 50C overnight. Contaminants were removed by phenol:CHCl3 extraction and DNA was precipitated in 70% ethanol. DNA was quantitated spectrophotometrically at 260 nm. DNA was analyzed by Southern blotting and hybridization. Briefly, 20 µg of genomic DNA was digested with EcoRI and HindIII and the digest was separated on a 0.8% agarose gel. DNA was depurinated in situ for 15 minutes at room temperature in 0.125 N HCl. The gel was rinsed with H2O and the DNA was denatured in 0.5 M NaOH and 0.5 M NaCl twice for 15 minutes at room temperature. The gel was rinsed in 10x standard saline citrate (SSC) and DNA was transferred to a nitrocellulose membrane (Schleicher & Schuell, Keene, NH). The membrane was baked for 2 hours at 80C and DNA was prehybridized in 6x SSC, 5x Denhardt's, 0.5% SDS, and 100 µg/ml of single-stranded calf thymus DNA for 6 hours at 65C. The DNA was then hybridized in prehybridization buffer containing 1.5 x 106 deca s per minute/ml of 32P-labeled probe at 65C for 16 hours. After hybridization, the membrane was washed twice in 2x SSC and 0.1% SDS for 30 minutes at 65C and then twice in xX SSC and 0.1% SDS for 30 minutes at 65C. Air-dried blots were autoradiographed onto Kodak MS XAR film (Eastman Kodak, Rochester, NY) with an intensifying screen.

RNA analysis

PTEN mRNA was assayed by northern blotting and hybridization. Briefly, equal amounts of total cellular RNA (20 µg) were separated on a 6% formaldehyde and 1% agarose gel. RNA was transferred to a nylon membrane (ICN, Costa Mesa, CA) and baked for 2 hours at 80C. Murine PTEN cDNA was radioactively labeled by random priming and hybridized in 50% formamide at 42C for 36 hours. Blots were washed twice in 2x SSC and 0.1% SDS for 30 minutes at 65C and then twice in 1x SSC and 0.1% SDS for 30 minutes at 65C. Air-dried blots were autoradiographed as described for Southern blotting.

Protein analysis

For western blotting, control fibroblasts and canine OS cell lines were harvested in ice-cold RIPA buffer (150 mM NaCl, 1% nonidet-P40, 0.5% deoxycholate, and 0.1% SDS, 50 mM Tris, pH 8.0) containing phenylmethyl–sulfonylfluoride (1 mM), aprotinin (1%), leupeptin (20 µg/ml), and sodium orthovanidate (1 mM). Equal amounts of protein (15 µg) were electrophoresed through a 10% SDS polyacrylamide gel. Protein bands were transferred to nitrocellulose by means of a Bio Rad (Hercules, CA) semidry electroblotter. Filters were blocked in 4% milk powder in Tris-buffered saline (pH 7.6) containing 0.05% Tween 20 and incubated with specific antibodies overnight at 4C. After washing, filters were incubated with the appropriate horse radish peroxidase–conjugated secondary antibody, washed, and then processed for detection by the Renaissance Western Blot Chemiluminescence Reagent (NEN Life Science Products, Boston, MA) and Biomax ML film (Eastman Kodak, Rochester, NY).

Immunohistochemistry

Indirect immunoperoxidase staining was performed by the streptavidin–biotin technique with a commercial kit from Zymed Laboratory (South San Francisco, CA) and the MicroProbe staining system (Fisher Scientific, Pittsburgh, PA). Two- to 4-µm sections of formalin-fixed paraffin-embedded tissue were deparaffinized in xylene, rinsed in graduated ethyl alcohols (100%, 95%, and 70%), and transferred from 70% ethanol to 0.5% H202 in methanol for 10 minutes to block endogenous peroxidase. Sections were rinsed in 0.01 M phosphate-buffered saline (PBS), pH 7.2, containing 0.4% BRIJ-35 (Sigma Chemical Co., St. Louis, MO) and incubated for 10 minutes with 10% normal goat serum. The normal serum was tapped off and the sections were incubated with mouse (immunoglobulin [IgG]2a) monoclonal PTEN antibody (A2B1, 1 µg/ml Santa Cruz Biotechnology Inc., Santa Cruz, CA) for 2 hours at 37C. After rinsing with PBS-BRIJ, sections were incubated with biotinylated anti-mouse immunoglobulins for 10 minutes at room temperature. Sections were rinsed with PBS-BRIJ and incubated with streptavidin–biotin complex for 15 minutes at room temperature. Sections were rinsed with PBS-BRIJ and incubated with the DAKO amplification reagent (DAKO Corporation, Carpinteria, CA) for 15 minutes at room temperature. Sections were again rinsed with PBS-BRIJ and incubated with the streptavidin–peroxidase conjugate at room temperature for 10 minutes. After a final rinse in PBS-BRIJ, sections were reacted with aminoethyl carbazole and 0.01% H2O2 (Zymed Laboratory) for 10 minutes at room temperature. The reaction was stopped by rinsing in distilled water. Sections were counterstained with Gill's No. 2 Hematoxylin (Fisher Scientific) for 30 seconds, rinsed in distilled water, and cover slipped with glycerol vinyl alcohol aqueous mounting solution (Zymed Laboratory). All incubations were carried out in a humid chamber. For the negative control, Control Mouse Ascites Fluid Clone NS-1 (M 8273, Sigma Chemical Co.) was substituted for the antibody at a concentration of 1 µg/ml. Blocking peptide experiments were performed with PTEN blocking peptide (sc-7974 P, Santa Cruz Biotechnology Inc., Santa Cruz, CA). Antibody (2 µg/ml) was incubated with a 30-fold stoichiometric excess of blocking peptide for 1 hour at room temperature with gentle stirring. The mixture was applied to tissue sections in place of antibody alone in the protocol described above. PTEN-specific staining was absent in sections pretreated with PTEN-blocking peptide.

Sequencing of PTEN cDNA

RNA isolated from CO3 was used to synthesize cDNA as described previously with primers specific for canine PTEN cDNA (GenBank accession No. U92435; forward primer GCTATGGGGTTTCCTGCAG starting at nucleotide 207 and reverse primer TCTCTGGGTCAGAGTCAGTG ending at nucleotide 1273).19 The 1,066 base pair (bp) PCR product, representing amino acids 34–388, was cloned into the T vector (Promega, Madison, WI) and the DNA was sequenced by the Cornell University Bioresource Center with BIG DYE terminators from PE Biosystems and run on ABI 3700 and ABI 377 DNA Sequencers. DNA sequences were verified by sequencing at least three independent clones.


   Results
Top
 Abstract
 Materials and Methods
 Results
Discussion
 References
 
PTEN is mutated in canine OS cell lines

Western blotting analysis indicated that PTEN protein was absent or expressed at very low levels in OS cell lines CO2, CO5, and CO7, as compared to primary canine fibroblasts (Fig. 1). OS cell lines deficient in PTEN protein contain elevated levels of phosphorylated Akt, as does CO3. The level of phosphorylated Akt (Ser 473) often is elevated in PTEN-deficient cells and tumors and is used here as an indirect assay of Akt and PTEN activity.32,43 Levels of total Akt protein are similar in all of the OS cell lines and slightly higher in control fibroblasts. Only CO8 exhibits a wild-type expression pattern: high levels of PTEN protein and low levels of activated Akt. Consistent with the protein data, CO2 and CO5 do not express PTEN mRNA, whereas CO7 expresses low levels of a normal-sized and a larger molecular weight PTEN RNA (Fig. 2).



View larger version (79K):
[in this window]
[in a new window]
  		Fig. 1. Inactivation of PTEN in canine OS cell lines. Protein extracts were prepared from exponentially growing cells and analyzed by western blotting (15 µg/lane) with antibodies to PTEN, phosphorylated (ser 473) Akt (pAkt), and total Akt.
Fig. 2. Abnormal PTEN RNA expression in canine OS cell lines. Twenty micrograms of total RNA from each cell line was analyzed by northern blotting using the murine PTEN cDNA probe. Ethidium bromide–stained ribosomal RNA (28s and 18s) was used to control for equal loading.

 
To determine whether gross alterations in PTEN gene structure are responsible for the observed aberrant PTEN expression, high molecular weight DNA was isolated and subjected to Southern blotting, with a full-length murine PTEN cDNA probe (Fig. 3). Four major and three minor hybridizing bands are apparent in the control, CO3, and CO8 lanes. In contrast, three of the four major bands (9.2 kb, 1.5 kb, and 0.8 kb) and several of the minor bands (6.4 kb, 5.8 kb, and 1.9 kb) are absent from CO2 and CO5. CO7 contains the normal pattern of hybridization; however, the reduced band intensities relative to the control lane are consistent with a monoallelic deletion of the gene. These results indicate that a deletion of a large part of the PTEN gene is responsible for the inability of CO2 and CO5 to express PTEN protein and contributes to the mutant phenotype of CO7.



View larger version (57K):
[in this window]
[in a new window]
  		Fig. 3. PTEN is deleted in canine OS cell lines. Fifteen micrograms of genomic DNA from a control dog (C) and each cell line was digested with EcoRI and HindIII and analyzed by Southern blotting with a PTEN cDNA probe.

 
The results presented above indicate that Akt is activated in CO3. To determine whether CO3 contains a mutation that inactivates PTEN without affecting PTEN protein levels, PTEN cDNA was cloned and the DNA was sequenced. CO3 PTEN contains an A to T substitution at nucleotide 1126, codon 340, which substitutes a tyrosine for an asparagine.

Inactivation of PTEN in canine OS tumors

To examine PTEN expression in primary tumors, tissue sections were prepared from 15 canine osteosarcomas and stained with PTEN antibody (Table 1). Only five tumors were uniformly positive for PTEN staining. Six tumors were negative and four tumors exhibited variable PTEN staining. Representative PTEN-positive–staining (OS 1) and negative–staining (OS 10) tumors are shown in Figs. 4 and 5.



View larger version (66K):
[in this window]
[in a new window]
  		Fig. 4. Osteosarcoma; dog; OS No. 1. Section of tumor and vessel exhibiting diffuse cytoplasmic staining of tumor cells. The arrow points to positive-staining endothelial cells (internal positive control). DAB. Bar = 50 µm.
Fig 5. Osteosarcoma; dog; OS No. 10. Section of tumor and vessel exhibiting a diffuse lack of positive-staining. The arrow points to positive staining endothelial cells (internal positive control). DAB. Bar = 50 µm.

 
Genomic DNA samples from a control dog, a dog with a PTEN-positive–staining tumor (OS 1), and a dog with a PTEN-negative–staining tumor (OS 13) were subjected to Southern blotting and analyzed for the integrity of PTEN gene structure (Fig. 6). OS 13 essentially lacks PTEN hybridizing bands of 9.2, 6.4, 5.8, 1.9, and 0.8 kb. Very faint 9.2 and 0.8 kb bands are visible, but likely represent contamination of tumor samples with reactive fibroblasts and endothelial cells. A duplicate blot probed with Jnk1 produced identical banding patterns in all three lanes. These results indicate that OS 13 contains a homogenous deletion of a large part of the PTEN gene.



View larger version (48K):
[in this window]
[in a new window]
  		Fig. 6. PTEN is deleted in canine OS 13. Genomic DNA was isolated from fresh samples of OS 1 and OS 13 and analyzed by Southern blotting with a PTEN or JNK1 cDNA probe. Small differences in band migration between samples likely are due to incomplete removal of salt during DNA purification.

 

   Discussion
Top
 Abstract
 Materials and Methods
 Results
 Discussion
References
 
Canine OS cell lines and tumors contain mutations that directly or indirectly inactivate p53 and Rb family genes.17,19,23 These tumor suppressors act at cell cycle checkpoints primarily to regulate cell proliferation, differentiation and survival in response to internal and external environmental signals.18,29,41 Additional mutations likely are required to confer other essential cellular properties characteristic of tumor cells, including self-sufficiency in growth signals, sustained angiogenesis, tissue invasion, and metastasis.15 The tumor suppressor PTEN plays an important role in regulating many of the cellular behaviors that commonly are deregulated during tumorigenesis.7,10 Therefore, it is not surprising that PTEN is inactivated in a large number of human tumors.

Mutations in the PTEN gene are present in at least three of five canine OS cell lines and are coincident with increased levels of phosphorylated Akt. PTEN deletions are frequently associated with the loss of PTEN protein in sporadic human tumors.2 Two of the OS cell lines, CO2 and CO5, contain large deletions in both PTEN alleles. CO7 contains a deletion of one PTEN allele and likely contains a mutation in the remaining allele, which results in low levels of an aberrantly sized PTEN mRNA and very low levels of protein.

The remaining OS cell line, CO3, contains a misregulated phosphoinositide 3-kinase/Akt signaling pathway, as indicated by the constituitively elevated levels of phosphorylated Akt. We identified a single base change in PTEN cloned from CO3 that results in a tyrosine to asparagine amino acid substitution at codon 340. Although this specific mutation has not been identified in human cancers, mutations within this region of the C-terminal end of human PTEN have been shown to alter protein folding and impair phosphatase activity.12 Whether this substitution represents a mutation that alters PTEN function or a polymorphism within the gene must await the results of functional studies.

In contrast to the other OS cell lines, CO8 expresses normal levels of PTEN protein and activated Akt. Given the importance of the phosphoinositide 3-kinase/Akt signaling pathway in regulating cell proliferation and survival, it is reasonable to speculate that a mutation in a distinct pathway antagonizes PTEN action, providing an alternative mechanism to bypass this important tumor suppressor.

As a tumor suppressor gene, PTEN expression is downregulated in tumors and tumor cell lines by genetic and epigenetic mechanisms.2,44 Unlike the p53 tumor suppressor, mutations in the PTEN gene do not generally result in elevated levels of PTEN protein.2,3 The fact that PTEN immunostaining of OS tumor sections is variable or negative in 10 of 15 tumors argues that PTEN expression is downregulated in a high percentage of canine osteosarcomas. The mechanisms leading to PTEN downregulation in most of these tumors is unknown, but at least one PTEN-negative tumor (OS 13) contains a deletion of a large portion of the PTEN gene. The mutational inactivation of PTEN in at least three of five OS cell lines provides additional support for the hypothesis that PTEN mutations occur frequently in canine OSs.

Canine OS occurs primarily in older dogs, although a significant proportion of affected animals are less than 5 years of age. Early-onset human cancers often are associated with the inheritance of mutated tumor suppressor genes, including PTEN.2,13 All four of the early-onset OSs in dogs less than 5 years of age that we examined were negative for PTEN immunostaining. However, our preliminary results indicated that the one early-onset tumor for which the appropriate genomic DNA samples were available (OS 13) does not contain a corresponding germline mutation in the PTEN gene (data not shown).

In humans, the majority of mutations in PTEN have been identified in epithelial cell-derived tumors, including cancers of the breast, endometrium, prostate, kidney, and glia.2,7 PTEN(±) mice develop a variety of tumors that are similar, but not identical to, the types of tumors observed in humans.30,33 In humans and mice, PTEN inactivating mutations therefore are linked to the development of tumors of specific tissues and histologic types. To our knowledge, PTEN mutations have not been associated with the occurrence of OS. Therefore, it is significant that PTEN is mutated or downregulated in a high percentage of canine OS cell lines and tumors. These data underscore the important role that PTEN plays in negatively regulating tumorigenesis in mesenchymal as well as epithelial cell types.

The expression of exogenous PTEN in PTEN-deficient epithelial cell–derived tumor cells has multiple effects depending on the cell type that is used. PTEN can inhibit proliferation; block anchorage-independent growth; inhibit cell spreading, migration, and invasiveness; and stimulate apoptosis.16,22,25,26,36,42 Reintroducing PTEN into PTEN-deficient mouse embryo fibroblasts sensitizes cells to various proapoptotic stimuli, but does not alter the rate of cell proliferation under normal growth conditions.32,34 An understanding of the role that PTEN plays in the pathogenesis of canine OS must await further experiments in which PTEN activity is restored in OS cell lines and tumors.


   Acknowledgments
 
We are grateful to Sean Mc Donough and Clive Huxtable for helpful discussions and Margaret McEntee, Rodney Page, Susan Ettinger, and the oncologists and surgeons at Cornell Veterinary College for supplying fresh OS specimens.


   Footnotes
 
Dr. R. A. Levine, Department of Molecular Medicine (VMC C4–171), College of Veterinary Medicine, Cornell University, Ithaca, NY 14853 (USA). E-mail: ral1{at}cornell.edu. Back


   References
Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Ali IU: Gatekeeper for endometrium: the PTEN tumor suppressor gene. J Natl Cancer Inst 92:861-863, 2000[Free Full Text]
  2. Ali IU, Schriml LM, Dean M: Mutational spectra of PTEN/MMAC1 gene: a tumor suppressor with lipid phosphatase activity. J Natl Cancer Inst 91:1922-1932, 1999[Abstract/Free Full Text]
  3. Bonneau D, Longy M: Mutations of the human PTEN gene. Hum Mutat 16:109-122, 2000[CrossRef][Medline]
  4. Brunet A, Bonni A, Zigmond MJ, Lin MZ, Juo P, Hu LS, Anderson MJ, Arden KC, Blenis J, Greenberg ME: Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell 96:857-868, 1999[CrossRef][Medline]
  5. Cantley LC, Neel BG: New insights into tumor suppression: PTEN suppresses tumor formation by restraining the phosphoinositide 3-kinase/Akt pathway. Proc Natl Acad Sci USA 96:4240-4245, 1999[Abstract/Free Full Text]
  6. Cardone MH, Roy N, Stennicke HR, Salvesen GS, Franke TF, Stanbridge E, Frisch S, Reed JC: Regulation of cell death protease caspase-9 by phosphorylation. Science 282:1318-1321, 1998[Abstract/Free Full Text]
  7. Dahia PL: PTEN, a unique tumor suppressor gene. Endocr Relat Cancer 7:115-129, 2000[Abstract]
  8. Datta SR, Dudek H, Tao X, Masters S, Fu H, Gotoh Y, Greenberg ME: Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Cell 91:231-241, 1997[CrossRef][Medline]
  9. Davies MA, Lu Y, Sano T, Fang X, Tang P, LaPushin R, Koul D, Bookstein R, Stokoe D, Yung WK, Mills GB, Steck PA: Adenoviral transgene expression of MMAC/PTEN in human glioma cells inhibits Akt activation and induces anoikis. Cancer Res 58:5285-5290, 1998[Abstract/Free Full Text]
  10. Di Cristofano A, Pandolfi PP: The multiple roles of PTEN in tumor suppression. Cell 100:387-390, 2000[CrossRef][Medline]
  11. Furnari FB, Huang HJ, Cavenee WK: The phosphoinositol phosphatase activity of PTEN mediates a serum-sensitive G1 growth arrest in glioma cells. Cancer Res 58:5002-5008, 1998[Abstract/Free Full Text]
  12. Georgescu MM, Kirsch KH, Akagi T, Shishido T, Hanafusa H: The tumor-suppressor activity of PTEN is regulated by its carboxyl-terminal region. Proc Natl Acad Sci USA 96:10182-10187, 1999[Abstract/Free Full Text]
  13. Guilford P: The inherited susceptibility to cancer. Cell Mol Life Sci 57:589-603, 2000[CrossRef][Medline]
  14. Guldberg P, Thor SP, Birck A, Ahrenkiel V, Kirkin AF, Zeuthen J: Disruption of the MMAC1/PTEN gene by deletion or mutation is a frequent event in malignant melanoma. Cancer Res 57:3660-3663, 1997[Abstract/Free Full Text]
  15. Hanahan D, Weinberg RA: The hallmarks of cancer. Cell 100:57-70, 2000[CrossRef][Medline]
  16. Hlobilkova A, Guldberg P, Thullberg M, Zeuthen J, Lukas J, Bartek J: Cell cycle arrest by the PTEN tumor suppressor is target cell specific and may require protein phosphatase activity. Exp Cell Res 256:571-577, 2000[CrossRef][Medline]
  17. Johnson AS, Couto CG, Weghorst CM: Mutation of the p53 tumor suppressor gene in spontaneously occurring osteosarcomas of the dog. Carcinogenesis 19:213-217, 1998[Abstract/Free Full Text]
  18. Levine AJ: p53, The cellular gatekeeper for growth and division. Cell 88:323-331, 1997[CrossRef][Medline]
  19. Levine RA, Fleischli MA: Inactivation of p53 and retinoblastoma family pathways in canine osteosarcoma cell lines. Vet Pathol 37:54-61, 2000[Abstract/Free Full Text]
  20. Liaw D, Marsh DJ, Li J, Dahia PL, Wang SI, Zheng Z, Bose S, Call KM, Tsou HC, Peacocke M, Eng C, Parsons R: Germline mutations of the PTEN gene in Cowden disease, an inherited breast and thyroid cancer syndrome. Nat Genet 16:64-67, 1997[CrossRef][Medline]
  21. Maehama T, Dixon JE: The tumor suppressor, PTEN/MMAC1, dephosphorylates the lipid second messenger, phosphatidylinositol 3,4,5-trisphosphate. J Biol Chem 273:13375-13378, 1998[Abstract/Free Full Text]
  22. Maier D, Jones G, Li X, Schonthal AH, Gratzl O, Van Meir EG, Merlo A: The PTEN lipid phosphatase domain is not required to inhibit invasion of glioma cells. Cancer Res 59:5479-5482, 1999[Abstract/Free Full Text]
  23. Mendoza S, Konishi T, Dernell WS, Withrow SJ, Miller CW: Status of the p53, Rb and MDM2 genes in canine osteosarcoma. Anticancer Res 18:4449-4453, 1998[Medline]
  24. Mertens WC, Bramwell V: Osteosarcoma and other tumors of bone. Curr Opin Oncol 6:384-390, 1994[Medline]
  25. Minaguchi T, Mori T, Kanamori Y, Matsushima M, Yoshikawa H, Taketani Y, Nakamura Y: Growth suppression of human ovarian cancer cells by adenovirus-mediated transfer of the PTEN gene. Cancer Res 59:6063-6067, 1999[Abstract/Free Full Text]
  26. Morimoto AM, Berson AE, Fujii GH, Teng DH, Tavtigian SV, Bookstein R, Steck PA, Bolen JB: Phenotypic analysis of human glioma cells expressing the MMAC1 tumor suppressor phosphatase. Oncogene 18:1261-1266, 1999[CrossRef][Medline]
  27. Myers MP, Pass I, Batty IH, Van der KJ, Stolarov JP, Hemmings BA, Wigler MH, Downes CP, Tonks NK: The lipid phosphatase activity of PTEN is critical for its tumor supressor function. Proc Natl Acad Sci USA 95:13513-13518, 1998[Abstract/Free Full Text]
  28. Nelen MR, van Staveren WC, Peeters EA, Hassel MB, Gorlin RJ, Hamm H, Lindboe CF, Fryns JP, Sijmons RH, Woods DG, Mariman EC, Padberg GW, Kremer H: Germline mutations in the PTEN/MMAC1 gene in patients with Cowden disease. Hum Mol Genet 6:1383-1387, 1997[Abstract/Free Full Text]
  29. Oren M: Regulation of the p53 tumor suppressor protein. J Biol Chem 274:36031-36034, 1999[Free Full Text]
  30. Podsypanina K, Ellenson LH, Nemes A, Gu J, Tamura M, Yamada KM, Cordon-Cardo C, Catoretti G, Fisher PE, Parsons R: Mutation of PTEN/MMAC1 in mice causes neoplasia in multiple organ systems. Proc Natl Acad Sci USA 96:1563-1568, 1999[Abstract/Free Full Text]
  31. Ru G, Terracini B, Glickman LT: Host related risk factors for canine osteosarcoma. Vet J 156:31-39, 1998[CrossRef][Medline]
  32. Stambolic V, Suzuki A, de la Pompa JL, Brothers GM, Mirtsos C, Sasaki T, Ruland J, Penninger JM, Siderovski DP, Mak TW: Negative regulation of PKB/Akt-dependent cell survival by the tumor suppressor PTEN. Cell 95:29-39, 1998[CrossRef][Medline]
  33. Stambolic V, Tsao MS, Macpherson D, Suzuki A, Chapman WB, Mak TW: High incidence of breast and endometrial neoplasia resembling human Cowden syndrome in PTEN± mice. Cancer Res 60:3605-3611, 2000[Abstract/Free Full Text]
  34. Sun H, Lesche R, Li DM, Liliental J, Zhang H, Gao J, Gavrilova N, Mueller B, Liu X, Wu H: PTEN modulates cell cycle progression and cell survival by regulating phosphatidylinositol 3,4,5,-trisphosphate and Akt/protein kinase B signaling pathway. Proc Natl Acad Sci USA 96:6199-6204, 1999[Abstract/Free Full Text]
  35. Tamura M, Gu J, Matsumoto K, Aota S, Parsons R, Yamada KM: Inhibition of cell migration, spreading, and focal adhesions by tumor suppressor PTEN. Science 280:1614-1617, 1998[Abstract/Free Full Text]
  36. Tamura M, Gu J, Takino T, Yamada KM: Tumor suppressor PTEN inhibition of cell invasion, migration, and growth: differential involvement of focal adhesion kinase and p130Cas. Cancer Res 59:442-449, 1999[Abstract/Free Full Text]
  37. Tamura M, Gu J, Tran H, Yamada KM: PTEN gene and integrin signaling in cancer. J Natl Cancer Inst 91:1820-1828, 1999[Abstract/Free Full Text]
  38. Teng DH, Hu R, Lin H, Davis T, Iliev D, Frye C, Swedlund B, Hansen KL, Vinson VL, Gumpper KL, Ellis L, El Naggar A, Frazier M, Jasser S, Langford LA, Lee J, Mills GB, Pershouse MA, Pollack RE, Tornos C, Troncoso P, Yung WK, Fujii G, Berson A, Steck PA: MMAC1/PTEN mutations in primary tumor specimens and tumor cell lines. Cancer Res 57:5221-5225, 1997[Abstract/Free Full Text]
  39. Theilen GH, Madewell BR: Tumors of the Skeleton. Veterinary Cancer Medicine. pp 471-489, Lea and Febiger, Philadelphia, PA 1987
  40. van Leeuwen IS, Cornelisse CJ, Misdorp W, Goedegebuure SA, Kirpensteijn J, Rutteman GR: p53 Gene mutations in osteosarcomas in the dog. Cancer Lett 111:173-8, 1997[CrossRef][Medline]
  41. Weinberg RA: The retinoblastoma protein and cell cycle control. Cell 81:323-330, 1995[CrossRef][Medline]
  42. Wick W, Furnari FB, Naumann U, Cavenee WK, Weller M: PTEN gene transfer in human malignant glioma: sensitization to irradiation and CD95L-induced apoptosis. Oncogene 18:3936-3943, 1999[CrossRef][Medline]
  43. Wu X, Senechal K, Neshat MS, Whang YE, Sawyers CL: The PTEN/MMAC1 tumor suppressor phosphatase functions as a negative regulator of the phosphoinositide 3-kinase/Akt pathway. Proc Natl Acad Sci USA 95:15587-15591, 1998[Abstract/Free Full Text]
  44. Zhou XP, Gimm O, Hampel H, Niemann T, Walker MJ, Eng C: Epigenetic PTEN silencing in malignant melanomas without PTEN mutation. Am J Pathol 157:1123-1128, 2000[Abstract/Free Full Text]
  45. Zundel W, Schindler C, Haas-Kogan D, Koong A, Kaper F, Chen E, Gottschalk AR, Ryan HE, Johnson RS, Jefferson AB, Stokoe D, Giaccia AJ: Loss of PTEN facilitates HIF-1–mediated gene expression. Genes Dev 14:391-396, 2000[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Clin. Cancer Res.Home page
N. K. Pryer, L. B. Lee, R. Zadovaskaya, X. Yu, J. Sukbuntherng, J. M. Cherrington, and C. A. London
Proof of Target for SU11654: Inhibition of KIT Phosphorylation in Canine Mast Cell Tumors
Clin. Cancer Res., November 15, 2003; 9(15): 5729 - 5734.
[Abstract] [Full Text] [PDF]

Home page
 Vet PatholHome page
R. A. Levine
Overexpression of the Sis Oncogene in a Canine Osteosarcoma Cell Line
Vet. Pathol., May 1, 2002; 39(3): 411 - 412.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Levine, R. A.
Right arrow Articles by Smith, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Levine, R. A.
Right arrow Articles by Smith, C.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS